MUMBAI, India, July 5 -- Intellectual Property India has published a patent application (202517047872 A) filed by Saint-Gobain Performance Plastics Corporation, Solon, U.S.A., on May 17, for 'aptamers, containers and methods for cell transduction.'
Inventor(s) include Campbell, Katie; Fekete, Natalie; Wheatley, Jonathan; Rodriguez, Jessica; Gibb, Maranda; Liao, Albert, M.; and Caltagirone, Thomas.
The application for the patent was published on July 4, under issue no. 27/2025.
According to the abstract released by the Intellectual Property India: "This disclosure relates generally to nucleic acid aptamers especially useful for cell transduction, as well as to containers (such as bags) having surfaces comprising one or such aptamers, and to transductions methods using such aptamers and containers. One embodiment of the disclosure provides A DNA aptamer comprising a plurality of nucleotides, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 1 (AAACTGCAGCGATTCATTAGTACGGCCTTT)."
The patent application was internationally filed on Nov. 20, 2023, under International application No.PCT/US2023/080578.
Disclaimer: Curated by HT Syndication.
